Articles
DNA Genetic Markers
Laboratories and main stream media are beginning to use the term genetic markers quite frequently but most individuals only have a brief understanding of what exactly is a genetic marker. This article provided to you by AccuMolecular Diagnostics briefly explains what genetic markers are and what it means to you when it comes to paternity testing.In simple words, a genetic marker is a gene or easily recognizable DNA sequence with a known location on a chromosome. A chromosome is a thread-like structure in which a DNA molecule is packaged into. Each chromosome is composed of tightly coiled DNA with Histone proteins supporting its structure. It is the DNA within these chromosomes that are the building blocks of life. The chromosomes reside within the nucleus of cells and are the same throughout the entire body.
A genetic marker is further defined by being locus-specific, polymorphic in the specific population, and easily genotyped. Before a part of the DNA can be used as a genetic marker, it must be determined that the sequence in that specific location is relatively different between individuals. There are stretches in the DNA that will not vary among people and such sequences are not useful in identification or analysis that depends on differences among individuals. You’ve probably heard of the term allele used when reading about genetics. An allele is a different sequence in the DNA between two or more individuals at the same locus, or location in their DNA.
Certain genetic markers are of higher quality than others due to a couple of factors. The quality of a genetic marker is determined by the probability that the parent is heterozygous (has two different alleles for a trait) times the probability that one could identify which DNA sequence of a given parent was given to the offspring. When it comes to determining parentage and human identification, a certain type of genetic marker called Short Tandem Repeat (STR) is used.
A STR genetic marker occurs when a sequence is repeated next to each other and can be the length of anywhere from two to ten base pairs. Currently in forensic analysis and human identification, tetra or penta-nucleotide STRs are used given their high level of error-free data and the ability to survive degradation through rough conditions. The DNA scientist begins the analysis by extracting the DNA from a sample and counting the number of STR sequence repeats in several loci points. The number of repeats in the different loci develops a genetic profile for an individual which can then be compared for similarity to others.
To give a quick example, let’s assume the following is a certain part of a person’s DNA sequence and we’re starting at a tetra-nucleotide (pattern of 4) STR locus:
TGCATGCATGCATGCATGCAACTGGTCATCAG
For this example, the tetra-nucleotide STR is TGCA. In the sequence TGCA is repeated next to each other 5 times. The number of times that it is repeated will be different between two unrelated individuals. If someone is the offspring of the two samples provided (mother and father), then the offspring will have the same number of repeats as the mother or the father.
Certain anomalies and mutations might occur at STR markers or further testing may be required in paternity testing to exclude relatives and thus genetic profiling of an individual is a complicated process. For this reason, at AccuMolecular Diagnostics, genetic profiling and paternity testing is only conducted by a Physician M.D. with a Ph.D.
In the United States, 13 core STR loci have been established as the basis to determine an individual’s genetic profile. This is the standard that the U.S. Government forensic agencies abide by for human identification. However, AccuMolecular Diagnostics has taken a step further and uses three additional STR loci for a total of 16 to enhance the accuracy in determining an individual’s genetic profile.
AccuMolecular Diagnostics is a leading blood and genetic testing facility based in San Antonio, Texas with collection sites nationwide. The laboratory has achieved several levels of accreditation by the Clinical Laboratory Improvement Amendments (CLIA), College of American Pathologists (CAP), and the U.S. Centers for Medicare & Medicaid Services.
This article is © 2008, AccuMolecular Diagnostics. This copyrighted article can not be copied, transmitted, or used without the express written consent of AccuMolecular Diagnostics.
